Un groupe d’éclosions d’ecthyma causées par un seul clone de Streptococcus pyogenes envahissant et hautement infectieux

Contexte L’ecthyma est une infection cutanée ulcérée invasive Quatre éclosions d’ecthyma ont eu lieu dans différentes unités d’infanterie de la Force de défense israélienne d’octobre à février. Les taux d’attaque de morbidité lors des premiers foyers étaient de% des soldats,% et Dans le premier groupe d’épidémies, les soldats ont souffert de glomérulonéphrite post-streptococcique et des cas de séquelles systémiques ont été enregistrés en cas de choc septique sévère, de pneumonie et de cas de On a isolé des isolats de S pyogenes chez des soldats affectés et non affectés impliqués dans toutes les éclosions. Résultats Bien que les isolats de S aureus aient des profils génomiques différents, plus de% des isolats de S pyogenes ont été identifiés comme appartenant à une variété de bactéries. clone unique, type emm, type T Epi L’enquête démiologique a révélé que les niveaux d’hygiène des soldats et leurs conditions de vie étaient probablement la cause la plus importante de la différence des taux d’attaque, de la gravité des plaies et des séquelles systémiques trouvées entre et au sein des unités. souche S pyogenes virulente et hautement infectieuse et de mauvaises conditions de vie, et souligne l’importance d’une intervention précoce dans de telles conditions

Streptococcus pyogenes streptocoque du groupe A β-hémolytique [GAS] est un agent pathogène très répandu qui provoque un large éventail de maladies dans la communauté La gravité de la maladie causée par ce pathogène varie de légère par exemple, pharyngite ou impétigo à des conditions potentiellement mortelles, par exemple, nécrosante fasciite et choc septique La méthode de typage emm est un schéma de génotypage des souches de GAS basé sur la variabilité du gène emm, qui code pour l’antigène capsulaire M. La variabilité génétique du GAS joue un rôle significatif dans le tropisme tissulaire et les manifestations cliniques associées à leur infection; certaines des souches ont une forte affinité avec la muqueuse du pharynx, d’autres sont plus susceptibles de provoquer des lésions cutanées et la plupart des souches peuvent infecter les deux tissus Certains types de souches, comme emm, emm et emm, ont tendance à Les lésions sont généralement superficielles et n’impliquent pas le derme. L’impétigo est généralement indolore, cicatrise sans laisser de cicatrices et n’entraîne généralement pas de séquelles ou de complications. , sauf pour la glomérulonéphrite streptococcique Bien que les infections streptococciques cutanées surviennent principalement chez les enfants, elles peuvent être significatives et même invalidantes chez les adultes qui vivent dans des conditions environnementales et hygiéniques médiocres [, -], notamment chez les soldats soumis à des traumatismes cutanés et une mauvaise hygiène L’ecthyma est une forme unique et plus invasive d’infection de la peau par le GAS Contrairement à l’impétigo, elle implique des Nous décrivons de grandes poussées d’ecthyma causées par un seul clone de SAG survenu chez de jeunes soldats d’infanterie en bonne santé de la Force de défense israélienne. Une quatrième épidémie causée par le même SGA clone, dans lequel l’intervention précoce a été établie, a entraîné un taux d’attaque significativement plus faible et moins de morbidité

Matériaux et méthodes

En novembre, la Direction générale de la santé de l’armée israélienne a été informée de la morbidité cutanée inhabituellement répandue parmi les soldats servant dans une unité d’infanterie composée de stagiaires de base et de personnel de commandement. Une enquête sur les éclosions La Direction générale de la santé de l’Armée a informé les médecins qui servaient dans toutes les autres unités des Forces de défense israéliennes des résultats de cette enquête sur les éclosions et leur a demandé de signaler une morbidité similaire. des unités d’infanterie non apparentées impliquées; Une autre unité comprenait des stagiaires et du personnel de commandement. Une autre éclosion a été signalée des mois plus tard dans une unité composée de stagiaires et de personnel de commandement. Cette éclosion s’est produite parmi une cohorte supplémentaire de soldats de la même unité. Lors de cette quatrième épidémie, une intervention précoce a été entreprise Tous les soldats de l’unité impliquée dans la première éclosion ont reçu des échantillons initiaux en novembre, puis des échantillons ont été prélevés deux fois de plus, une semaine et des semaines après les premiers échantillons. Les flambées subséquentes ont été enregistrées et des échantillons ont été prélevés en décembre et en janvier, et des échantillons ont été prélevés en février auprès de soldats impliqués dans la quatrième épidémie. Chacune des éclosions s’est produite dans des unités entièrement composées de soldats. soldats soldats suivaient une formation de base. Nous avons obtenu des échantillons provenant d’unités d’une taille similaire avec des modèles d’entraînement similaires qui ne présentaient pas de lésions cutanées épidermiques. Ces unités n’ont pas rapporté de morbidité cutanée ou de lésions cutanées non invasives enregistrées. une éclosion légère d’impétigo a été signalée en novembre, alors que l’examen des autres unités a eu lieu en mars. Un total de sujets des unités témoins ont été inclus dans l’étude. Tous les sujets témoins étaient des soldats hommes qui suivaient une formation de base. le personnel de commandement des unités épidémiques et de contrôle a été examiné cliniquement pour rechercher des lésions cutanées suspectées et des signes de pharyngite. Des échantillons de prélèvements de gorge ont été prélevés auprès de% des soldats dans les unités épidémiques et de% des soldats dans les unités témoins. % des soldats dans les unités de l’épidémie et% des soldats dans le contrôle Les soldats impliqués dans le premier foyer ont été réexaminés cliniquement, et des échantillons de culture ont été obtenus des semaines pour les soldats et des semaines pour les soldats. après notification de l’éclosion Définition du cas Un patient était un soldat d’une unité impliquée dans l’éclosion qui avait ⩾ une lésion cutanée confirmée par les spécialistes des maladies infectieuses comme étant une lésion ecthymaire et des lésions cutanées.

Figure Vue largeTélécharger la lameCaractéristiques ecthyma caractéristiquesFigure Voir grandTélécharger la lameCaractéristique ecthyma lésions

Figure View largeTélécharger slideCaractéristiques ecthyma lésionsFigure View largeTélécharger une lameCaractéristiques ecthyma lésionsAdministration antimicrobienne Le traitement lors de la première éclosion a été initié par les médecins de l’unité et n’était pas uniforme Trois jours après la détection de cette éclosion, la crème mupirocine Bactroban; GlaxoSmithKline a été administré localement à tous les soldats affectés dans cette unité. En outre, tous les soldats de l’unité ont reçu l’ordre d’utiliser septum pour leurs douches quotidiennes Quarante-cinq des soldats touchés ont reçu une injection intramusculaire d’un million de benzathine pénicilline G et de ces soldats Une dose unique d’azithromycine par voie orale a également été administrée par voie orale. De plus, la cloxacilline a été administrée par voie orale aux soldats touchés, principalement dans les cas où un grand nombre de lésions étaient présentes ou la maladie était sévère. Méthodes de laboratoire Des échantillons pharyngiens, nasaux et lésionnels ont été obtenus en utilisant des écouvillons de Copan Amies Copan Diagnostics, étalés sur des plaques de gélose au sang de mouton standard, et incubés à ° C. dans l’air ambiant pour h GAZ ont été identifiés en utilisant Oxoid kits Oxoid Après l’identification, la souche s ont été incorporés dans% glycérol et stockés à-° C jusqu’à ce que le typage de l’EMN a été effectué insuffisance rénale chronique. Immunoturbidimetric test pour la détermination quantitative des anticorps anti-streptolysine O dans le sérum humain a été réalisée sur l’analyseur Olympus, comme recommandé par le fabricant. La préparation de lysat de typage et la PCR ont été réalisées comme décrit dans la base de données de séquences EMAS des Centers for Disease Control et Prevention, avec des modifications mineures Parce que les bactéries ont été isolées d’une épidémie présumée, longueur du fragment de restriction emm des séquences de polymorphisme ont été obtenues pour éviter l’analyse séquentielle de l’ensemble des types d’emm identiques Deux digestions enzymatiques séparées ont été réalisées en utilisant l’enzyme de restriction DdeI BioLabs et les enzymes de restriction HaelII et HincII BioLabs. Les fragments de restriction ont été résolus par électrophorèse sur% Nuseive; gel d’agarose Cambrex L’image numérique du gel a été analysée en utilisant le logiciel Bionumerics Applied-Maths Des isolats sélectionnés de chaque épidémie ont été soumis au séquençage du gène emm Les produits de PCR ont été purifiés avec un kit de purification QIAquick PCR Qiagen puis soumis au séquençage. Recommandations de CDC pour la détermination de la région codante hypervariable emm utilisant l’amorce emmseq ‘TATTCGCTTAGAAAATTAAAAACAGG’ par séquençage automatique Hy Laboratories La séquence des bases – a été soumise, en utilisant le formulaire de demande de sous-typage du streptocoque du groupe A, au Blast Core Facility Computing Laboratory , où type de emm a été déterminé PFGE a été réalisée comme décrit ailleurs , avec plusieurs modifications figure

Figure vue grandDownload slidePFGE analyse des souches de l’épidémie et des souches de contrôle M, marqueur de masse moléculaire; -, souches témoins ayant le même type T et emm que les souches de l’épidémie; -, isolats représentatifs de l’épidémie; et, isolats représentatifs de l’éclosion; et, isolats représentatifs de l’éclosion; et des isolats représentatifs de la flambée survenue dans une autre compagnie du même régiment que la compagnie qui était impliquée dans la flambée. Figure Vue largeTélécharger la lamePFGE analyse des souches de la flambée et des souches témoins M, Marqueur de masse moléculaire; -, souches témoins ayant le même type T et emm que les souches de l’épidémie; -, isolats représentatifs de l’épidémie; et, isolats représentatifs de l’éclosion; et, isolats représentatifs de l’éclosion; Les données épidémiologiques ont été enregistrées à l’aide du logiciel Microsoft Excel. L’analyse univariée de l’association entre toutes les variables dichotomiques a été évaluée à l’aide du test exact de Fisher. Multivarié l’analyse a été effectuée en utilisant le modèle logistique inconditionnel La valeur AP de a été considérée comme statistiquement significative pour toutes les variables testées Toutes les données ont été analysées par le logiciel SPSS, version pour Windows SPSS

Résultats

Début de l’épidémie L’âge moyen ± SD des soldats dans les unités était de ± ans, – ans L’âge moyen ± SD des soldats de contrôle était de ± ans, – Cent dix-huit pour cent des soldats ont été affectés dans les premiers foyers, avec taux d’attaque de%,% et% pour les flambées -, respectivement, alors que dans la quatrième flambée, seulement% des soldats étaient affectés

Tableau View largeTélécharger les caractéristiques environnementales, comportementales et cliniques associées aux unités d’épidémies ecthyma et aux unités de contrôleTable View largeTélécharger les caractéristiques environnementales, comportementales et cliniques associées aux unités d’épidémie ecthyma et aux unités de contrôleDans tous les foyers, les stagiaires de base ont été affectés, tandis que le personnel de commande n’a pas été affecté Par conséquent, le personnel de commandement a été exclu de l’analyse épidémiologique. Le début des éclosions précoces est survenu à peu près au même moment en octobre et le début de la quatrième éclosion plusieurs mois plus tard durant l’hiver. Un cas de pneumonie et de choc toxique streptococcique syndrome a précédé le début de la première épidémie Ce patient était déjà malade en août, mois avant le début de la morbidité chez les autres soldats de l’unité. Les manifestations cliniques Les lésions d’Ecthyma se situaient principalement sur les jointures et les tibias, mais les lésions sur le visage derrière les oreilles. , sur le t des hauteurs et des coudes ont également été observés. Bien que toutes les poussées aient été de type ecthyma, la morbidité était plus prononcée dans le premier foyer que dans les autres foyers. Le nombre de plaies par patient était plus élevé et les lésions plus importantes. ulcération plus profonde que les lésions typiques dans les autres foyers Bien que la morbidité ait été limitée à la peau dans tous les foyers,% des sujets impliqués dans la flambée ont également présenté une pharyngite biliaire caractérisée par un mal de gorge et des exsudats caractéristiques. a été hospitalisé en octobre avec une pneumonie lobaire, et son état s’est détérioré rapidement, nécessitant une ventilation mécanique et un traitement de soutien dans une unité de soins intensifs, plus tard identifiée comme type, a été isolé à partir du sang de ce patient échantillons, et le patient a reçu un diagnostic de syndrome de choc toxique streptococcique Récupération complète a eu lieu dans les semaines Neuf autres soldats ont également connu des manifestations cliniques sévères; le soldat avait une bursite septique olécrânienne qui nécessitait une incision chirurgicale et un drainage; d’autres soldats avaient une pneumonie lobaire non compliquée; Les unités de la flambée et les unités de contrôle comprenaient des soldats en bonne santé d’âge similaire qui pratiquaient une activité physique intense pour les soldats de l’infanterie. Cette activité comprenait souvent des ecchymoses aux mains et aux jambes. Les soldats des unités et, cependant, vivaient dans des conditions plus encombrées avec des conditions d’hygiène moins bonnes que les soldats résidaient dans une tente prévue pour, et les soldats résidaient dans une pièce conçue pour, respectivement, et la fréquence de la douche était significativement plus basse dans ces unités, par rapport à la fréquence dans les autres unités une fois par semaine vs une fois par jour Les taux d’attaque dans les foyers, et étaient élevés%,% et%, respectivement En outre, la flambée était le seul foyer dans lequel des manifestations systémiques sévères ou glomérulonéphrite ont été enregistrées dans [%] des soldats Bien que les soldats dans l’unité de l’épidémie vivaient dans des conditions % unité d’épidémie était également la seule unité dans laquelle des mesures d’intervention précoce ont été prises jours après le début, par rapport aux jours après le début de la flambée épidémique. Facteurs de risque intra-unitaires L’analyse univariée et multivariée des facteurs de risque démographiques et comportementaux a montré que l’acquisition et la sévérité de la morbidité n’étaient pas associées au tabagisme, au nombre de frères et soeurs ou au pays de naissance. Les observations microbiologiques GAS et Staphylococcus aureus ont été isolées à partir des plaies de l’ecthyma, de l’oropharynx et des narines antérieures. Cependant, l’apparition de plaies était positivement associée à l’isolement du GAZ pharyngé. % IC, -, alors qu’aucune association de ce type n’a été observée avec l’isolement nasal de S aureus OR; Plus de% des isolats de GAS dans chacun des foyers ont été identifiés comme type emm, table de type T Comme révélé par PFGE, tous les profils génomiques des isolats analysés étaient indiscernables en utilisant des enzymes de restriction séparées et pouvaient être distingués de souches non apparentées du même type T et emm que les souches épidémiques Ces résultats incluaient la souche GAS isolée chez le sujet ayant eu un syndrome de choc toxique streptococcique. Cependant, les isolats de S aureus présentaient de nombreux profils génomiques différents, comme le démontrent les données d’analyse PFGE pas montré

Tableau View largeTélécharger slideIsolation du streptocoque du groupe A dans les unités d’épidémies ecthyma et dans les unités de contrôleTable AgrandirDisolation du streptocoque du groupe A dans les échantillons d’écouvillonnage de la gorge, du nez et de la lésion dans les unités ecthyma et les unités de contrôleEradication bactérienne Ces soldats ont été réexaminés et plusieurs semaines après l’administration du premier traitement antibiotique. Les taux de colonisation du SGA pharyngée ont diminué de% des soldats avant le traitement antimicrobien à% des soldats. Les examens physiques effectués quelques semaines après le début de l’éclosion ont révélé que seuls les soldats avaient des plaies ouvertes d’ecthyma sécréteur et que tous les autres n’avaient que des cicatrices. Aucun nouveau cas d’ecthyma ont été enregistrés après le début du traitement

Discussion

Les preuves les plus importantes sont l’isolement du seul clone de GAS dans toutes les poussées, contrairement à la grande variabilité des clones parmi les isolats de S aureus. Les flambées causées par ce seul clone de GAS étaient caractérisées par une forme sévère de lésions, contrairement aux épidémie d’impétigo qui ont été décrites ailleurs [,,], et par un taux exceptionnellement élevé de lésions cutanées parmi les unités dans lesquelles aucune intervention précoce n’a été appliquée. De plus, des taux élevés de morbidité systémique et de glomérulonéphrite ont été observés dans les unités. que le type emm, type T, GAZ qui a provoqué ces flambées est une souche virulente et extrêmement infectieuse. Ce fait est significativement supporté par la comparaison du type emm, du type T, des unités d’épidémie avec les unités de contrôle; dans ces unités de contrôle, où les conditions de vie et les types d’activité étaient similaires mais où différentes souches de SGA étaient isolées, les plaies étaient significativement moins fréquentes et moins sévères qu’elles ne l’étaient dans les unités dans lesquelles le type emm, type T, était responsable La souche de type emm présente un profil E, ce qui indique une prédilection pour la colonisation de la muqueuse pharyngienne et de la peau En effet, cette souche a été fréquemment isolée des écouvillons et des écouvillons de gorge dans les foyers décrits. ces flambées épidémie, il a été associé à la pharyngotillinite clinique chez les soldats% de l’unité Cette souche est très répandue dans certaines parties du monde ; Dans d’autres régions, par exemple, les États-Unis, il est rare que la prévalence de la souche en Israël soit actuellement inconnue, bien que dans une étude récemment menée dans le corps médical israélien, cette souche n’ait été ni isolée des porteurs du GAS ni isolé des sujets avec amygdalite pharyngée données non publiées Malgré le fait que tous les foyers ont été causés par le même clone, une variabilité remarquable de la manifestation de la maladie a été observée, tant entre les unités qu’au sein des unités. unité-à-unité au sein du cluster épidémie, il est tentant de spéculer que les facteurs environnementaux et comportementaux jouent un rôle dans les manifestations de la maladie, même parmi les infections qui sont dues au même clone que le personnel de commandement, qui vivaient dans de meilleures conditions , n’ont pas été touchées suggère l’importance d’une mauvaise hygiène et de conditions de vie surpeuplées en contribuant aux épidémies Cette constatation est en conformité w Les conclusions de Taplin et al , qui rapportent que la prévalence de la pyodermite streptococcique est associée à un climat humide et à une mauvaise hygiène, montrent qu’une mauvaise hygiène affecte non seulement la prévalence de la maladie, mais aussi L’analyse de l’épidémie a suggéré que l’intervention, sous la forme d’une administration d’antibiotiques et d’une amélioration des conditions d’hygiène et de vie, réduisait à la fois la morbidité et le portage du SGA. La survenance d’un taux de morbidité significativement plus faible en cas d’épidémie, où les niveaux d’encombrement et d’hygiène étaient similaires aux conditions associées à une flambée où les taux de morbidité atteignaient%, suggère que prendre ces mesures tôt au cours de l’épidémie peut réduire considérablement taux d’attaque, la gravité des manifestations de la maladie et le nombre complications systémiques et séquellesLa prophylaxie systématique par l’administration intramusculaire de benzathin pénicilline, pratique courante dans les populations à risque de l’armée américaine, a été associée à une réduction de la prévalence de la pneumonie à SGA L’administration d’un traitement prophylactique similaire pourrait prévenir ou au moins réduire l’ampleur de ces flambées dans la Force de défense israélienne Cependant, cette politique devrait être soigneusement examinée, car les inconvénients d’une telle pratique pourraient l’emporter sur les avantages, par exemple, la promotion de la résistance aux antimicrobiens et la possibilité de réactions indésirables dues à l’allergie à la pénicilline, y compris anaphylaxie potentiellement mortelle Aucune source commune apparente pour toutes les épidémies n’a pu être identifiée, mais l’utilisation de l’analyse épidémiologique moléculaire nous a permis de tirer des conclusions importantes concernant l’importance de l’hygiène et des conditions de vie dans le développement d’une telle épidémie. l’armée israélienne des forces de défense Les règlements existants concernant les conditions de vie surpeuplées et les douches quotidiennes ont été renforcés et les médecins militaires ont été avisés d’informer la Direction générale de la santé de l’armée de toute grappe suspecte de morbidité pharyngée. Un comité spécial composé de spécialistes des maladies infectieuses et d’épidémiologie attribué à cette question ont décidé de ne pas recommander un traitement antibiotique prophylactique pour les soldats d’infanterie dans la formation de base

Remerciements

Conflits d’intérêts potentiels Tous les auteurs: pas de conflits