Diagnostic moléculaire des infections opportunistes du système nerveux central chez les adultes zambiens infectés par le VIH

Il s’agit de la première étude exhaustive en Afrique subsaharienne sur l’ensemble des infections opportunistes du système nerveux central dans la population séropositive. Cette étude souligne que de nombreux agents pathogènes sont souvent présents dans le liquide céphalorachidien des personnes vivant avec le VIH.

Contexte Connaissance des infections opportunistes du système nerveux central (SNC) chez les personnes vivant avec le virus de l’immunodéficience humaine VIH en Afrique subsaharienne est limitée Méthodes Nous avons analysé l’échantillon de liquide céphalorachidien du LCR de chacun des adultes infectés par le VIH avec des symptômes évocateurs d’ICS dans un centre de soins tertiaires. Zambie Nous avons utilisé des amorces spécifiques aux agents pathogènes pour détecter l’ADN du virus JCV JCV, du virus varicelle-zona VZV, du cytomégalovirus CMV, du virus Epstein-Barr EBV, du virus herpès simplex HSV et Mycobacterium tuberculosis et Toxoplasma gondii via PCR en temps réel PCRResults Le nombre médian de lymphocytes T CD des patients était de cellules / μL intervalle interquartile, – cellules / μL d’échantillons de LCR,% avaient au moins ADN pathogène détecté ADN provenant de EBV chez% patients, M tuberculose en%, JCV en%, CMV en% , VZV en%, HSV- en%, et HSV- et T gondii in none Les études fongiques et bactériologiques ont montré Cryptococcus chez% patients, pneumocoque en%, et méningocoque en% Mult 100% des patients hospitalisés sont morts au cours de leur hospitalisation. Les hommes étaient plus âgés que les femmes, contre des années; P =, plus récemment diagnostiqué avec le VIH médian, vs jours; P =, et avaient tendance à avoir un taux de mortalité plus élevé% vs%; P = Conclusions Les IO du SNC sont des complications fréquentes et potentiellement traitables du SIDA en Zambie Les pathogènes multiples coexistent souvent dans le LCR L’EBV est l’organisme CNS le plus répandu isolé et co-infecté Qu’il soit associé à la maladie du SNC ou un marqueur d’inflammation nécessite une investigation plus approfondie le dépistage des agents pathogènes du SNC pourrait améliorer le traitement et les résultats pour les patients en Zambie

VIH, Zambie, liquide céphalorachidien, PCR, infections opportunistesNeurologic complications in% -% des personnes infectées par le virus de l’immunodéficience humaine VIH Parmi les complications neurologiques les plus graves du VIH sont des infections opportunistes OI du système nerveux central CNS Zambie a l’un des Les taux les plus élevés d’infection à VIH dans le monde avec une prévalence globale de%, approchant% dans certaines populations urbaines Le liquide céphalorachidien CSF est couramment obtenu à partir de patients en Afrique subsaharienne soupçonnés d’avoir une infection du SNC. En conséquence, les données spécifiques au pays en Afrique concernant la prévalence des infections du système nerveux central sont rares et les patients restent insuffisamment traités. En particulier, ils sont absents de la majorité. de ces études sont les données de prévalence des IO du SNC diagnostiquées par PCR en chaîne par polymérase La PCR du LCR est la technique de diagnostic standard utilisée dans les milieux riches en ressources pour détecter la présence d’IO bactériennes virales, parasitaires et spécifiques du système nerveux central; cependant, la PCR n’est actuellement pas utilisée pour le dépistage systématique des infections opportunistes chez les patients infectés par le VIH en Zambie ou dans la majorité de l’Afrique subsaharienne. Nous avons cherché à déterminer la prévalence des infections du système nerveux central chez les adultes zambiens infectés par le VIH. résultats

Méthodes

Population de patients

Cette étude transversale a été menée à l’hôpital universitaire UTH de Lusaka en Zambie entre octobre et mai et a été approuvée par le comité d’éthique de la recherche biomédicale de l’école de médecine de l’université de Zambie et le Beth Israel Deaconess Medical Center. Adultes infectés qui se sont présentés aux urgences de l’UTH avec des symptômes suggérant une infection du SNC nécessitant une ponction lombaire LP dans le cadre de l’évaluation de routine Symptômes spécifiques: méningisme, céphalée, altération de la conscience, convulsions ou déficit neurologique focal Les patients ou les mandataires de soins de santé ont alors fourni un consentement écrit pour l’utilisation de l’excès de liquide céphalorachidien inutile pour les études de routine. Au moment de l’inscription, un neurologue de l’étude OKS a documenté les données démographiques des patients. présentant des symptômes, des antécédents médicaux et un examen neurologique Dans le cadre du protocole hospitalier, tous les patients recevant un LP ont une microscopie, une culture, une coloration de Gram et un test d’encre de l’Inde sur un test de Crise du LCR, lorsqu’ils sont disponibles, aux frais de ~US $. hospitalisation pour documenter le résultat de la sortie ou de la mort

Test CSF

Tous les tests de CSF ont été effectués dans notre laboratoire moléculaire à l’UTH. L’excès de CSF obtenu à partir de chacun de ces patients a été aliquoté dans des tubes stériles simples et stockés à – ° C pour le diagnostic moléculaire. L’ADN a été extrait par lots de μL de CSF avec Qiagen MinElute kit Qiagen, Germantown, Maryland Nous avons réalisé des tests de PCR pour Mycobacterium tuberculosis tuberculosis, Epstein-Barr virus EBV, virus JC JCV, virus varicelle-zona VZV, cytomégalovirus CMV, virus herpès simplex type HSV-, virus herpès simplex type HSV-, et Toxoplasma gondii Dix microlitres de Une solution d’ADN a été utilisée pour chaque réaction de PCR. Le contrôle d’extraction consistait en des amorces stériles d’eauPCR de qualité moléculaire et des sondes ont été précédemment décrites ou conçues en utilisant Primer Express Life Technologies, Grand Island, New York. Sciences, Sydney, Australie utilisant Applied Biosystems Roche, Branchburg, New Jersey Les conditions de rmocycler étaient ° C pour minutes, ° C pour minutes, cycles de ° C pour secondes, puis ° C pour minute et ° C pour minutes Table Polymerase Chain Reaction Amorces and Probes Gène pathogène cible, référence Sense Primer ‘-‘ Antisense Primer ‘ – ‘Probe’ – ‘EBV B- BNRFa GGAACCTGGTCATCCTTTGC ATGGACCGGTTAATCCGATCT AGCGAGCAGTACGAGTGCCTGCGb La tuberculose est AGGCGAACCCTGCCCAG GATCGCTGATCCGGCCA TGTGGGTAGCAGACCTCACCTATGTGTCGA JCV T gène ADN AGAGTGTTGGGATCCTGTGTTTT GAGAAGTGGGATGAAGACCTGTTT TCATCACTGGCAAACATTTCTTCATGGC CMV polymerasea CTTAACCACTACAGCAAAGGTACGA ATGATAGCGGCGTTAGGTGACA TGCCCGAAACGAATAGCGTTGCC VZV ADN polymerase CGGCATGGCCCGTCTAT TCGCGTGCTGCGGC ATTCAGCAATGGAAACACACGACGCC HSV gD CGGCCGTGTGACACTATCG CTCGTAAAATGGCCCCTCC CCATACCGACCACACCGACGAACC HSV-gG CGCTCTCGTAAATGCTTCCCT TCTACCCACAACAGACCCACG CGCGGAGACATTCGAGTACCAGATCG Toxo B CAAGCAGCGTATTGTCGAGTAGAT GCGTCTCTTTCATTCCCACATTTT CAGAAAGGAACTGCATCCGTT Pathogène Goudron obtenir Gene, Sense Référence Primer ‘-‘ Primer anti-sens ‘-‘ Probe ‘-‘ B- VEB BNRFa GGAACCTGGTCATCCTTTGC ATGGACCGGTTAATCCGATCT AGCGAGCAGTACGAGTGCCTGCGb la tuberculose AGGCGAACCCTGCCCAG GATCGCTGATCCGGCCA TGTGGGTAGCAGACCTCACCTATGTGTCGA JCV T gène ADN CMV AGAGTGTTGGGATCCTGTGTTTT GAGAAGTGGGATGAAGACCTGTTT TCATCACTGGCAAACATTTCTTCATGGC polymerasea CTTAACCACTACAGCAAAGGTACGA ATGATAGCGGCGTTAGGTGACA TGCCCGAAACGAATAGCGTTGCC VZV ADN polymérase [ ] CGGCATGGCCCGTCTAT TCGCGTGCTGCGGC ATTCAGCAATGGAAACACACGACGCC HSV gD CGGCCGTGTGACACTATCG CTCGTAAAATGGCCCCTCC CCATACCGACCACACCGACGAACC HSV- gG CGCTCTCGTAAATGCTTCCCT TCTACCCACAACAGACCCACG CGCGGAGACATTCGAGTACCAGATCG Toxo B CAAGCAGCGTATTGTCGAGTAGAT GCGTCTCTTTCATTCCCACATTTT CAGAAAGGAACTGCATCCGTT abréviations: CMV, le cytomégalovirus; EBV, virus d’Epstein-Barr; HSV, virus de l’herpès simplex; JCV, virus JC; Toxo, Toxoplasma gondii; VZV, varicella zoster virusa Conception en interne avec PrimerExpress Life Technologiesb Toutes les sondes ont FAM comme colorant rapporteur et TAMRA comme extincteur, sauf la sonde Toxo, qui utilise un extincteur non fluorescent Miner groove binder Contrôles positifs MGB constitués d’ADN génomique pour chaque agent pathogène ATCC, Manassas, Virginia Deux contrôles négatifs pour chaque PCR ont consisté en un contrôle d’extraction et de l’eau stérile Tous les échantillons ont été traités en double Un échantillon a été considéré positif si les résultats montraient des produits amplifiés Si seulement des échantillons étaient positifs après le test initial, un second test PCR a été effectué Si le second PCR a montré une amplification, l’échantillon a été considéré comme positif Les résultats n’ont pas été utilisés pour les soins aux patients dans le cadre de cette étude observationnelle pilote Pour minimiser la variabilité inter-essais, les échantillons ont été testés par lots, généralement plusieurs semaines après la présentation initiale du patient.

Analyses statistiques

Les intervalles de confiance pour les taux de mortalité ont été estimés en utilisant des méthodes pour des intervalles de confiance binomiaux exacts. Des tests exacts de Wilcoxon et de Fisher ont été utilisés pour comparer les variables d’étude entre groupes. Des modèles de régression logistique univariée et multivariée ont été utilisés pour évaluer les prédicteurs de décès. a été utilisée pour sélectionner les variables pour les analyses multivariées. La méthode du maximum de vraisemblance a été utilisée pour estimer les paramètres du modèle et la signification a été testée à l’aide de la statistique du test de Wald. ont été pris en compte et considérés comme statistiquement significatifs si & lt;

RÉSULTATS

Caractéristiques du patient

Les caractéristiques des patients sont présentées dans le tableau La répartition par sexe était similaire, mais les hommes étaient plus âgés et plus récemment diagnostiqués avec le VIH que les femmes Globalement,% des patients ont été diagnostiqués avec une infection VIH au moment de la présentation. La numération des lymphocytes T CD tendait à être plus faible chez les hommes que chez les femmes Cent dix-neuf% des patients avaient des antécédents de tuberculose. Seuls% des patients étaient sous traitement antirétroviral combiné TARTE au moment de l’enrôlement pour une durée médiane interquartile. L’exposition au TARa tendait à être plus élevée chez les femmes que chez les hommes Tableau Démographie des patients N = Caractéristique Hommes Femmes P Valeur Non%% Âge, y, médiane IQR – – Cellules T CD / μL, médiane IQR – – Sur CARI au moment de l’hospitalisation%% Jours depuis le diagnostic du VIH, IQR médian – – Caractéristiques Hommes Femmes P Valeur Non%% Âge, y, médiane IQR – – Cellules T CD / μL, média n IQR – – Sur le TARc au moment de l’hospitalisation%% Jours depuis le diagnostic du VIH, médiane de l’IQR – – Abréviations: cART, traitement antirétroviral combiné; VIH, virus de l’immunodéficience humaine; IQR, gamme interquartile

Pathogènes infectieux détectés dans le liquide céphalorachidien

Le nombre de patients diagnostiqués avec ou plus de pathogènes est indiqué dans le tableau. Les tests d’encre étaient positifs sur% d’échantillons de LCR testés. Parmi ces échantillons,% étaient également positifs à la levure sur des échantillons de Gram. % ont été trouvés positifs Les tests de CrAg étaient nettement plus sensibles que l’encre de Chine pour le diagnostic de la méningite cryptococcique P & lt; Des tests suffisants pour faire un diagnostic de méningite cryptococcique soit de la levure, soit de l’encre de Chine positive, soit des tests de CrAg ont été réalisés sur% des échantillons,% avaient un organisme et% avaient plusieurs organismes détectés EBV était le pathogène le plus commun trouvé% et le copathogène le plus courant. des taux élevés de détection de Cryptococcus% et de tuberculose% Nous avons également détecté JCV%, CMV%, VZV% et HSV-% dans cette population de patients La pneumococcie et la méningite méningococcique ont été diagnostiquées en% et% de patients, respectivement Aucun cas de toxoplasmose ou HSV- ont été détectés par PCR Tableau Caractéristiques des patients atteints de pathogènes des fluides cérébro-spinaux Pathogènes Prédominance individuelle du LCR Pathogène Nombre de cas Pathogènes Nombre de cas Pathogènes Nombre de cas Pathogènes Nombre de cas EBV /% EBV EBV / Crypto EBV / TB / CMV EBV / Crypto / TB / VZV Cryptoa /% Crypto EBV / TB EBV / TB / JCV Crypto / TB / VZV / CMV TB /% TB EBV / VZV EBV / TB / Meningo JCV /% JCV EBV / JCV EBV / TB / Crypto CMV /% CMV EBV / Pneumo EBV / Crypto / JCV VZV /% VZV EBV / CMV EBV / JCV / CMV Pneumo /% HSV- EBV / HSV- EBV / JCV / VZV HSV- /% HSV- Crypto / CMV Méningère /% Toxo Crypto / VZV HSV- /% Pneumo Crypto / TB Toxo /% Crypto / HSV-TB / CMV TB / JCV TB / VZV JCV / Pneumo JCV / HSV- CMV / Meningo Totaux pathogènes /% /% / % /% Pathogènes Prédominance individuelle du LCR Agent pathogène Nombre de cas Pathogènes Nombre de cas Pathogènes Nombre de cas Pathogènes Nombre de cas EBV /% EBV EBV / Crypto EBV / TB / CMV EBV / Crypto / TB / VZV Cryptoa /% Crypto EBV / TB EBV / TB / JCV Crypto / TB / VZV / CMV TB /% TB EBV / VZV EBV / TB / Meningo JCV /% JCV EBV / JCV EBV / TB / Crypto CMV /% CMV EBV / Pneumo EBV / Crypto / JCV VZV /% VZV EBV / CMV EBV / JCV / CMV Pneumo /% HSV- EBV / HSV- EBV / JCV / VZV HSV- /% HSV- Crypto / CMV Meningo /% Toxo Crypto / VZV HSV- /% Pneumo Crypto / TB Toxo /% Crypto / HSV- TB / CMV TB / JCV TB / VZV JCV / Pneumo JCV / HSV- CMV / Meningo Totaux pathogènes /% /% /% /% Abréviations: CMV, cytomégalovirus; Crypto, Cryptococcus neoformans; LCR, liquide céphalo-rachidien; EBV, virus d’Epstein-Barr; HSV, virus de l’herpès simplex; JCV, virus JC; Meningo, méningocoque; Pneumo, pneumocoque; TB, Mycobacterium tuberculosis; Toxo, Toxoplasma gondii; VZV, varicella zoster virusa Cent quatre-vingt-quatre% des patients ont subi des tests suffisants. Les tomodensitogrammes et IRM ne sont pas systématiquement pratiqués en Zambie, mais sont disponibles pour les patients qui peuvent payer respectivement l’équivalent de US $ et $ Les patients peuvent bénéficier de tarifs réduits ou d’exonérations si les coûts sont jugés prohibitifs. Ces examens ont été réalisés uniquement chez quelques individus et n’ont pas été systématiquement analysés pour cette étude. Les analyses post mortem sont rarement réalisées au CHU en raison de la difficulté d’obtenir le consentement des membres de la famille.

Présence de convulsions chez les patients infectés par la peste porcine classique

Des crises ont eu lieu chez% des patients, y compris% de ceux avec et sans% agents pathogènes spécifiques dans leur LCR P = Saisie a été le plus souvent vu avec Cryptococcus%, JCV%, ou VZV% Saisie également dans les cas avec détection de CSV du VHS -%, EBV%, CMV% et tuberculose% La crise n’était pas un symptôme de présentation dans tous les cas de méningite à pneumocoque ou méningococcique

Mortalité et présentation clinique des patients infectés par le LCR et saisies

Parmi les patients,% sont décédés pendant leur hospitalisation, dont% hommes et% femmes P = En outre,% des patients ayant un pathogène détectable dans le LCR sont décédés, comparé à% décès chez les patients sans pathogène détecté P = Le pourcentage de patients diagnostiqués La mortalité des patients positifs pour le virus de l’herpès labial était de 0%. La présentation clinique des patients positifs pour le virus de la peste porcine était variable, y compris les céphalées, les cervicales et les convulsions Mortalité chez les patients diagnostiqués Histogramme du nombre d’échantillons de liquide céphalo-rachidien avec pathogène détectable appartenant à des patients restés vivants ou morts pendant leur hospitalisation Abréviations: Bactéries, pneumocoques ou méningocoques; CMV, cytomégalovirus; Crypto, Cryptococcus neoformans; LCR, liquide céphalo-rachidien; EBV, virus d’Epstein-Barr; HSV, virus de l’herpès simplex; JCV, virus JC; TB, Mycobacterium tuberculosis; VZV, Virus de la varicelle et du zonaFigure View largeTélécharger la diapositive Mortalité associée au pathogène Histogramme du nombre d’échantillons de liquide céphalo-rachidien avec pathogène détectable appartenant à des patients restés vivants ou morts pendant leur hospitalisation Abréviations: Bactéries, pneumocoques ou méningocoques; CMV, cytomégalovirus; Crypto, Cryptococcus neoformans; LCR, liquide céphalo-rachidien; EBV, virus d’Epstein-Barr; HSV, virus de l’herpès simplex; JCV, virus JC; TB, Mycobacterium tuberculosis; VZV, varicella zoster virus La mortalité des patients testant PCR positive pour la tuberculose CSF était de% Au total, une infection virale ou tuberculose a été diagnostiquée par PCR du LCR chez des patients, y compris avec CMV, VZV, HSV- ou tuberculose pour lesquels des traitements spécifiques sont disponibles. [/] Tableau récapitulant les facteurs de risque potentiels de décès dans notre population étudiée Les probabilités de décès ainsi que les intervalles de confiance en% ont été rapportés pour chaque covariable Une durée plus longue de diagnostic du VIH et un score GCS de Glasgow élevé ont été associés à des probabilités plus faibles de décès, alors que le sexe féminin et une durée plus longue ont montré une tendance avec moins de chance de mort. Inversement, tuberculose, méningite cryptococcique, EBV et autres. Les pathogènes ont montré une tendance avec des chances de mort plus élevées Il n’y avait pas de différence de mortalité entre les patients qui avaient un ou plusieurs agents pathogènes dans le LCR. analyse variée, seul le score GCS élevé est resté significatif Variables associées à la mortalité en analyse univariée et multivariée Variable Analyse univariée Analyse multivariée Rapport des cotes% CI P Valeur Rapport de cotes% CI P Valeur Femme catégorielle – – Situation cART – Tuberculose – Méningite cryptococcique – EBV – Autres pathogènes – Multiples agents pathogènes b – Continuous Age – Jours cART – – Journées de diagnostic VIH – – Nombre de CD – Glasgow Coma Scale – & lt; – Analyse univariée variable Analyse multivariée Cotes% CI P Valeur Rapport de cotes% CI P Valeur Femme catégorique – – Statut cART – Tuberculose – Méningite cryptococcique – EBV – Autres pathogènes – Multiples pathogènes b – Continuous Age – Jours cART – – Journées de diagnostic VIH – – Nombre de CD – Glasgow Coma Scale – & lt; – Abréviations: cART, traitement antirétroviral combiné; CI, intervalle de confiance; EBV, virus d’Epstein-Barr; VIH, virus de l’immunodéficience humainea D’autres pathogènes indiquent tous les autres agents pathogènes autres que l’EBV détectés dans le liquide céphalo-rachidien CSFb Des agents pathogènes multiples indiquent – des organismes détectés dans le LCR

DISCUSSION

maladie pulmonaire Les saisies sont également susceptibles d’être sous-déclarées, car les patients en Zambie ont une capacité limitée à identifier les crises qui ne sont pas convulsives Il existe également une stigmatisation significative associée aux saisies en Zambie , bien que des médicaments antiépileptiques soient disponibles. forme de carbamazépine et de phénobarbitone Le taux de mortalité était extrêmement élevé dans notre population étudiée Plus d’un tiers des patients sont décédés pendant leur hospitalisation Ce taux de mortalité est plus élevé que dans les pays riches en ressources au début de l’épidémie de sida Notre étude n’a pas été conçue pour un suivi à long terme Il est possible que la mort ait eu lieu après l’hospitalisation en raison d’une perte de suivi, d’une mauvaise observance du traitement et d’un accès insuffisant aux services de santé d’urgence. chez les patients avec des scores plus faibles sur GCS Les hommes présentant un temps plus court depuis le diagnostic initial du VIH, avaient une numération plus faible de lymphocytes T CD, et présentaient des taux de mortalité plus élevés. Les résultats suggèrent que les hommes sont plus présents que les femmes à des stades plus avancés de leur maladie VIH. Ceci est cohérent avec de nombreuses études en Afrique concernant les caractéristiques d’inscription et les résultats de traitement des patients se présentant aux cliniques cART Notre étude met en évidence plusieurs facteurs Dans un premier temps, le diagnostic précoce de l’infection par le VIH, en particulier chez les hommes, pourrait prévenir l’immunosuppression et les complications infectieuses. Deuxièmement, la disponibilité généralisée des tests CrAg dans le LCR sauverait des vies. Le test immunochromatographique CrAg Troisièmement, la mise en œuvre de technologies innovantes faisant appel à la PCR pour détecter les agents pathogènes viraux susceptibles d’être traités par le virus EBV, la tuberculose, le CMV, le VZV et le HSV peut améliorer la survie de ces virus. ces patients Cela pourrait potentiellement être fait à travers uti lisation de la plateforme de PCR en temps réel GeneXpert, qui est actuellement en cours d’extension dans des pays à ressources limitées pour améliorer le diagnostic de la tuberculose Le coût actuel d’une cartouche GeneXpert pour le test PCR d’un seul échantillon de tissu tuberculeux est de Un système comparable basé sur des cartouches pour tester les agents pathogènes du LCR pourrait facilement être développé. En Zambie, un programme national fournit un traitement antituberculeux gratuit, mais un traitement antiviral tel que l’acyclovir intraveineux ne peut être acheté que dans des pharmacies privées. $ par dose -mg Un cours typique pour l’encéphalite virale coûterait environ $ US et est hors de portée pour la plupart des patients Notre étude a plusieurs limites Le véritable degré d’infections et de co-infections a probablement été sous-estimé Le taux réel de tuberculose dans cette population est inconnu n’est pas systématiquement pratiqué sur le LCR en Zambie, car cela peut prendre des semaines avant de devenir positif. Le diagnostic de tuberculose la méningite est problématique quel que soit le contexte en raison de la sensibilité limitée des tests de PCR du LCR, estimée à environ% De nombreux patients ont été suspectés d’avoir une méningite tuberculeuse probable ou possible malgré un test PCR négatif. Les méningites cryptococciques étaient également sous-estimées car tous les patients ne recevaient pas de tests adéquats. Le salaire annuel moyen en Zambie est équivalent à US $ Les tests de CrAg sont couverts par le système de santé publique mais ne sont pas toujours disponibles. Dans ce contexte, les frais encourus pour les tests CrAg sont significatifs, puisque moins de la moitié des patients pour lesquels il était cliniquement indiqué ont subi ce test sur leur CSF. De même, les frais de TDM et d’IRM sont directement supportés par les patients. correspond à environ% -% du salaire annuel Il existe un système de paiement à plusieurs niveaux où pat Enfin, la neurocysticercose et la neurosyphilis peuvent également affecter les patients zambiens infectés par le VIH qui se présentent à l’UTH, mais en raison de ressources limitées, tous les patients n’ont pas bénéficié d’une évaluation adéquate. Notre étude montre que de nombreux agents pathogènes peuvent être trouvés dans le LCR des patients infectés par le VIH présentant des symptômes neurologiques en Zambie, et la mortalité de cette population est très élevée. La revue systématique de la littérature n’a montré aucun diagnostic moléculaire complet similaire. étude du SNC en Afrique subsaharienne Des études ciblées utilisant la PCR pour le diagnostic des herpèsvirus dans la méningite aseptique et la co-infection bactérienne chez des patients infectés par le VIH au Malawi Des tests diagnostiques pour un large éventail de pathogènes du LCR peuvent être nécessaires dans paramètres limités en ressources pour obtenir de meilleurs résultats et éviter les traitements inutiles ents

Remarques

Remerciements Les auteurs remercient le laboratoire de microbiologie de l’UTH pour son assistance technique. Ce travail a été soutenu par les numéros de subvention PA et RTW accordés par les National Institutes of Health à OKS et RNS, NS, et KNS à IJ KPotential conflits d’intérêts. Hoffman La Roche, GlaxoSmithKline, Merck Serono et Genentech; a reçu des honoraires de consultation de Bristol-Myers Squibb, de Ono Pharmaceuticals, de Merck Serono, de Hoffman La Roche, de GlaxoSmithKline, de Perseid Therapeutics, de Vertex Pharmaceutical et de Johnson & amp; Johnson; est membre du comité de rédaction du Journal of NeuroVirology; et reçoit des royalties de UpToDate pour des sujets sur la gestion des lésions de masse du VIH et du SNC et sur PML Tous les autres auteurs ne signalent aucun conflit potentiel Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits potentiels d’intérêts. manuscrit ont été divulgués