Diagnostic de l’encéphalite aiguë du virus de la tique du cerf

Contexte virus de la tique Deer DTV est un flavivirus transmis par les tiques qui n’a été apprécié récemment comme une cause d’encéphalite virale Nous décrivons la présentation clinique d’un patient qui avait DTV l’encéphalite diagnostiquée avant la mort et a survécu pendant des mois malgré dysfunctionMethods neurologiques graves Le diagnostic a été fait à partir un échantillon de liquide céphalorachidien, en utilisant un test de réaction en chaîne polymerase spécifique de flavivirus suivie d’une confirmation de la séquence, et la phylogénie ont été analysées tests sérologiques, y compris les tests de neutralisation par réduction de plages, a également été performedResults analyse moléculaire a indiqué que le virus était étroitement liée aux souches de DTV qui avait été détectée dans Ixodes scapularis du Massachusetts et dans le cerveau d’un patient de New York dans les Conclusions de l’encéphalite télévision numérique devrait être pris en compte dans le diagnostic différentiel d’encéphalite dans les zones géographiques qui sont endémiques pour la maladie de Lyme

virus de la tique du cerf, virus Powassan, méningoencéphalite, flavivirus, Ixodes scapularis Virus de la tique du dude DTV appartient au groupe des virus à ARN de l’encéphalite à tiques de la famille des flavivirus Parmi ces virus, DTV est le plus étroitement apparenté au virus Powassan. La lignée du virus Powassan ou, dans certaines publications, la lignée Powassan En raison de cette terminologie déroutante, la souche prototype du virus Powassan sera désignée sous le nom de virus POWV et le virus du cerf comme DTV bien que le DTV et le POWV soient antigéniquement apparentés. , ils semblent être maintenus dans des cycles enzootiques distincts La TVN est transmise par la tique Ixodes scapularis Bien que cette espèce de tique se soit révélée être un vecteur compétent pour le POWV dans les études en laboratoire , les tiques I scapularis n’ont pas été trouvées. infecté par le POWV, et donc cette espèce de tique ne semble pas servir de vecteur pour le POWV A ce jour, il n’y a que des cas publiés d’encéphalite DTV [ -] Le premier cas a été signalé en Ontario, au Canada, mais a été considéré comme causé par POWV jusqu’à ce que le séquençage génétique ait été fait plusieurs années plus tard Ce patient a survécu et a été libéré de l’hôpital. début de la maladie Le deuxième patient a développé une encéphalite DTV dans l’Etat de New York en et est décédé quelques jours après l’apparition des symptômes alors qu’il était encore hospitalisé. Les deux DTV et POWV sont la cause d’une méningo-encéphalite sévère rarement reconnue. Premier cas d’encéphalite DTV diagnostiquée au cours de la maladie aiguë Le patient a été traité par interféron gamma et ribavirine et a survécu pendant des mois mais avec des séquelles neurologiques sévères

CAS CLINIQUE

Un homme âgé de Putnam County, New York, a présenté en décembre une fièvre, une dysurie et une léthargie qui avaient débuté en novembre de la même année. Il était à Sarasota, en Floride, d’octobre à novembre. qui a fréquemment jardiné Sa fille a rapporté enlever une tique engorgé attaché à son abdomen en octobre, juste avant son voyage en Floride. Ses antécédents médicaux comprenaient l’hypertension, le diabète de type bien contrôlé, l’hyperlipidémie, la bronchopneumopathie chronique obstructive et la prostatite récidivante. avait une température de ° C, une pression artérielle de / mm Hg, un pouls de battements par minute, et une fréquence respiratoire de respirations par minute Sa prostate était élargie et légèrement tendre Le patient était confus mais n’avait pas de raideur de la nuque ou de focale Signes neurologiquesLes résultats de laboratoire ont montré une numération des globules blancs de cellules / mm, un taux d’hémoglobine de g / dL, et une numération plaquettaire de / mm Rénale et foie les résultats des tests de fonction se situaient dans la fourchette normale Les unités formant des colonies d’Escherichia coli / mL se sont développées dans une culture d’urine; les hémocultures étaient négatives. Le patient a été traité avec du céfépime. Le jour de l’hospitalisation, le patient est devenu comateux, nécessitant une intubation et un transfert à l’unité de soins intensifs; le même jour il a développé des secousses myocloniques de son membre supérieur droit avec des signes de raideur de la nuque. Un scanner de la tête était dans les limites normales. Le liquide céphalorachidien CSF a montré des globules blancs / mm avec% de lymphocytes, et un niveau de protéine de mg / dL Tableau Vancomycin, ampicillin, acyclovir, et fluconazole ont été ajoutés au traitement du patient

Tableau Oligo Séquences utilisées dans les tests moléculaires Powassan Oligo Nom Sequence Référence Amorces et sondes en temps réel POWV Pow-F ACCATAACAAACATGAAAGTCCAACT précédemment inédit Pow-F CCATCACAAACATGAAAGTCCAACT Pow-R TGAGTCTGCTGGTCCGATGAC Pow-R CTGTGAGTCAGCTGGTCCTATGAC Pow FAM-CCTTCCATCATGCGGAT-MGB Classique PCR et amorces de séquençage flavivirus CFD GTGTCCCAGCCGGCGGTGTCATCAGC Scaramozzino et al DGMB AACATGATGGGRAARAGRGARAA FS AARGGHAGYMCDGCHATHTGGT classiques PCR et des amorces de séquençage DTV DT-F AGCCGTTTCCTTGAGTTTGA Tavakoli et al DT-R CCATGTGAGGGTTGTCCAAA DT- GGTTGGTTGCTCAGGGAGCT DT – F GTAAGGATGTGGGCGAGT DT-R CATGGAAATGGTGTGAGCAG non publiées Oligo Nom de la séquence de référence en temps réel amorces et sonde POWV Pow-F ACCATAACAAACATGAAAGTCCAACT Pow-R CCATCACAAACATGAAAGTCCAACT Pow-R TGAGTCTGCTGGTCCGATGAC Pow-R CTGTGAGTCAGCTGGTCCTATGAC Pow PC-CCTTCCATCATGCGGAT-MGB PC non-conventionnel R et des amorces de séquençage flavivirus CFD GTGTCCCAGCCGGCGGTGTCATCAGC Scaramozzino et al DGMB AACATGATGGGRAARAGRGARAA FS AARGGHAGYMCDGCHATHTGGT PCR conventionnelle et séquençage des amorces DTV DT-F AGCCGTTTCCTTGAGTTTGA Tavakoli et al DT-R CCATGTGAGGGTTGTCCAAA DT- GGTTGGTTGCTCAGGGAGCT DT – F GTAAGGATGTGGGCGAGT DT-R CATGGAAATGGTGTGAGCAG Les abréviations non publié antérieurement : DTV, virus de la tique du cerf; PCR, amplification en chaîne par polymérase; POWV, Powassan virusView LargeA – électroencéphalogramme heure a montré une activité épileptique épisodique dans la zone centrale frontale gauche Le jour, l’imagerie par résonance magnétique du cerveau a montré amélioration dans les deux hémisphères cérébelleux, ainsi que dans les pédoncules, pons, et parahippocampus droit, compatible avec rhombencéphalite Les résultats d’autres tests de PCR du LCR pour les virus de l’herpès, les arbovirus, l’adénovirus et l’entérovirus étaient négatifs. Les échantillons de sérum et de sérum étaient négatifs pour l’IgG de l’immunoglobuline G et l’IgM de l’immunoglobuline M Les résultats sérologiques de la maladie de Lyme WNV de Lyme étaient négatifs. Le patient ne s’est pas amélioré neurologiquement malgré un traitement hebdomadaire d’interféron pégylé μg / semaine administré par voie sous-cutanée et de ribavirine mg deux fois par jour débutant le jour de l’hospitalisation. établissement de soins chroniques Le patient est resté comateux et di de pneumonie et d’insuffisance respiratoire des mois après la présentation

Figure Vue largeToile de diffusion Images de résonance magnétique du cerveau avec rehaussement du gadolinium le jour de l’hospitalisation rangée supérieure comparée à la rangée inférieure du jour Les images montrent un rehaussement dans les hémisphères cérébelleux bilatéraux au jour A, nettement amélioré au jour B; cependant, une nouvelle amélioration a été observée le jour dans les ganglions de la base droite C, qui avaient été absents lors de la présentation. DFigure View largeTélécharger les diapositives Images de résonance magnétique du cerveau avec rehaussement du gadolinium le jour de l’hospitalisation rangée supérieure par rapport à la rangée inférieure du jour les hémisphères cérébelleux au jour A, qui s’est nettement amélioré le jour B; Cependant, une nouvelle amélioration a été observée le jour dans les ganglions de la base droite C, qui avait été absent à la présentation D

Méthodes

Test sérologique

La sérologie a été réalisée au Centre Wadsworth du MIA pour détecter les anticorps IgA IgA contre la protéine d’enveloppe recombinante de la DTV sur des échantillons de sérum prélevés en décembre et janvier IgM MIA pour la protéine d’enveloppe DTV a été réalisée sur un échantillon de LCR collecté en décembre et des échantillons de sérum collectés en décembre et janvier après appauvrissement en IgG et détection par anti-IgM conjugué à la R-phycoérythrine Les résultats pour les anticorps totaux et pour les anticorps IgM ont été évalués en rapport Pour les billes réagissant avec le sérum du patient au MFI des billes ayant réagi avec un échantillon de sérum négatif, le résultat positif était une valeur des écarts-types supérieure au résultat MFI moyen basé sur un panel de sérums de sujets sains. d’un patient du Dutchess County, New York, qui avait été testé positif aux anticorps anti-POWV par cross-specie tests de neutralisation de la réduction de plaque au centre de Wadsworth Les protéines recombinantes de l’enveloppe DTV ont été produites à partir de la souche DTV-Ipswich, comme décrit ailleurs Des tests de neutralisation contre POWV et DTV ont été réalisés au Wadsworth Centre

Analyse moléculaire

Des échantillons de CSF collectés en décembre et janvier ont été testés par des tests moléculaires. L’acide nucléique total a été extrait du CSF avec un instrument easyMAG bioMerieux et des tests PCR en temps réel décrits ailleurs ont été réalisés pour détecter les virus responsables d’encéphalite. types de virus et virus varicelle-zona, cytomegalovirus, virus Epstein-Barr, adénovirus, herpèsvirus humain, entérovirus, virus du Nil occidental, virus de l’encéphalite équine de l’Est et virus de l’encéphalite St Louis SLEV A -step, RT-PCR en temps réel la détection de POWV et DTV a également été effectuée. Deux essais de RT-PCR héminestés conventionnels ont été utilisés pour générer du matériel pour le séquençage, ciblant la région non protéique de la protéine NS du DTV Un test a amplifié un fragment bp d’une paire de bases et l’autre amplifié un fragment de chevauchement de bp. Les détails techniques des tests PCR et du séquençage didésoxy sont fournis ci-dessous. -bp région du génome viral pour l’analyse phylogénétique Des études moléculaires supplémentaires ont été approuvées en vertu du numéro d’étude du Conseil d’examen institutionnel du Département de la santé de l’État de New York –

Pcr en temps réel

Un test de RT-PCR en temps réel A -step qui détecte les deux lignées du virus Powassan DTV et POWV a été réalisé en utilisant le système qRT-PCR Invitrogen SuperScript III Platinum. Chaque réaction -μL comprenait μL d’eau exempte de RNase, μL de × mélange réactionnel, μL de chacune des amorces sens et des amorces inverses à μmol / L, μL de la sonde à μmol / L, μL de mélange SuperScript III Platinum Taq et μL d’acide nucléique extrait comme matrice Conditions thermiques en une étape étaient les suivantes: minutes à ° C, suivies d’une étape d’activation de -minute à ° C, puis de cycles de ° C pour secondes et de ° C pour minute La cible génomique du test est dans le gène NS Séquences des amorces sens et antisens et la sonde sont montrées dans le tableau

RT-PCR conventionnelle à petits fragments

Les ensembles d’amorces héminestées classiques produisent un amplicon -bp au premier tour et un amplicon bp au second tour. Le test cible une région conservée du gène NS en utilisant des séquences d’amorces montrées dans des conditions de réaction de table, modifiées à partir de la publication originale, La réaction de RT-PCR au premier tour utilisait le kit OneStep RT-PCR Qiagen dans un volume total de -μL constitué de μL d’eau exempte de RNase, μL de tampon OneStep RT-PCR mmol / L de chlorure de magnésium, μL de mmol / L dNTP mix, μL de chaque amorce primaire à μmol / L, μL de mélange enzymatique RT-PCR OneStep, et μL d’ARN extrait de l’échantillon Les conditions thermiques cycliques étaient les suivantes: une étape RT initiale de minutes à ° C, suivi par une étape d’activation de l’enzyme Taq -minute à ° C, puis des cycles de ° C, ° C et ° C, chacun pour minutes, avec une étape finale d’extension de ° C de minutes. La réaction de PCR héminestée suivante comprenait μL de RNase -l’eau libre, μL de tampon de PCR × Qiagen mmol / L de magnésium, μL de mm ol / L dNTP, μL d’enzyme Qiagen HotStar Taq μ / μL, μL de chaque μmol / L des amorces héminestées et μL du produit de PCR du premier cycle comme matrice Les conditions de cycle thermique étaient une activation initiale à ° C pendant quelques minutes, puis cycles de ° C, ° C et ° C pour chaque minute, avec un pas d’extension final de -3 ° C

RT-PCR conventionnelle à grand fragment

Des amorces nouvellement conçues et publiées précédemment ont été utilisées pour produire un amplicon -bp au premier tour et un amplicon -bp au second tour. Le test cible une région conservée du gène NS avec la région cible légèrement chevauchante qui est ciblée par le petit fragment. RT-PCR La RT-PCR du premier cycle utilisait le kit RT-PCR de Qiagen OneStep. Chaque réaction -μL consistait en μL d’eau exempte de RNase, μL de tampon OneStep RT-PCR mmol / L de chlorure de magnésium, μL de mmol / L dNTP mix, μL de chaque amorce à μmol / L, μL de mélange enzymatique OneStep RT-PCR, et μL d’ARN échantillon extrait comme matrice Les conditions de cycle thermique étaient les suivantes: une étape RT initiale de minutes à ° C, suivie d’une -minute étape d’activation de l’enzyme Taq à ° C, puis cycles de ° C pour secondes, ° C pour minute, et ° C pour secondes, avec une étape d’extension finale de ° C de minutesChaque réaction de PCR héminisée comprend μL d’eau exempte de RNase , μL de tampon de PCR × Qiagen mmol / L de magnésium, μL de mmol / L d NTP, μL des unités d’enzyme Qiagen HotStar Taq / μL, et μL de chaque amorce à μmol / L, avec μL de produit de PCR du premier cycle comme modèle Les conditions de cycle thermique étaient les suivantes: une étape initiale d’activation de ° C pendant minutes, suivi de cycles de ° C pour les secondes, de ° C pour les minutes et de ° C pour les secondes, avec une étape finale d’extension de -minute à ° C

Analyse de séquence

Tous les produits de PCR ont été analysés sur un gel d’agarose% TBE coloré avec la coloration de gel d’ADN SYBR Safe Invitrogen et ont été purifiés en utilisant le kit Zymoclean Gel de récupération d’ADN Zymo Research ou PCR purifié en utilisant Quantum Prep PCR Colonnes Kine Spin Bio-Rad The Wadsworth Center Applied Genomic Technologies Le noyau a effectué le séquençage sur un instrument ABI, en utilisant les amorces de PCR nichées CFD et FS ou les amorces DT-, DT-R, DT-F et DT-R Table

RÉSULTATS

Immunologie

Le test MIA sur le LCR collecté le jour de l’hospitalisation était IgM réactif à la protéine d’enveloppe DTV, avec un taux de contrôle patient / négatif du sang collecté en jours et une IgM sérique fortement positive et une IgM IgA IgA polyvalente à la protéine d’enveloppe DTV. Le titre de PRNT pour une souche de DTV isolée à partir de tiques de I scapularis collectées dans le comté de Westchester en était également élevé, mais ce phénomène paradoxal reste à élucider mais a déjà été noté [ ,] et pourrait être lié aux souches virales particulières utilisées dans le test. Un test immuno-enzymatique ELISA du sang prélevé le jour de l’hospitalisation a été testé au Centre de contrôle et de prévention des maladies CDC et a été trouvé positif pour IgM et séparément pour IgG les anticorps dirigés contre la protéine de l’enveloppe POWV, avec un titre PRNT de CSF prélevé le jour étaient positifs pour les IgM et séparément pour les anticorps IgG par ELISA, avec un titre de PRNT de quand testé à la table CDC

Tableau Analyses de liquide céphalorachidien et de sang Laboratoire Jour Jour Jour Jour Plage normale Liquide cérébrospinal WBC, cellules / mm – RBC, cellules / mm – Différentiel,% Lymphocytes – Monocytes – Neutrophiles – Glucose, mg / dL – Protéine, mg / dL – LDH, U / L IgM MIA, P / N IgM ELISAb Positiveb IgG ELISAb Positifb PRNT titre b Sang globulaire, cellules / mm – Hémoglobine, g / dL – Plaquettes, cellules × / mm – Glucose, mg / dL – IgM MIA , P / N polyclonal, MIA, P / N IgM ELISAb Positifb Positifb IgG ELISAb Positifb Positifb PRNT titre b Laboratoire Test Jour Jour Jour a Jour Plage normale Liquide céphalo-rachidien WBC, cellules / mm – RBC, cellules / mm – Différentiel,% Lymphocytes – Monocytes – Neutrophiles – Glucose, mg / dL – Protéines, mg / dL – LDH, U / L IgM MIA, P / N IgM ELISAb Positiveb IgG ELISAb Positiveb PRNT titre b Globules blancs sanguins, cellules / mm – Hémoglobine, g / dL – Plaquettes, cellules × / mm – Glucose, mg / dL – IgM MIA, P / N polyclonal, MIA, P / N IgM ELISAb Positifb Positifb IgG ELISAb Positiveb Positiveb PRNT titre b Jours,,,, et correspond aux dates suivantes en décembre et janvier: décembre, décembre, décembre, janvier et janvierAbbreviations: ELISA, dosage immuno-enzymatique; IgG, immunoglobuline G; IgM, immunoglobuline M; LDH, lactate déshydrogénase; MIA, immunodosage des microsphères effectué au Wadsworth Center Arbovirus Laboratory; P / N, ratio de contrôle patient-à-négatif; PRNT, test de neutralisation de réduction de plaque; Globules rouges, globules rouges; WBCs, globules blancsa Un traitement par interféron pégylé et ribavirine a été initié le jour b. Tests réalisés au Laboratoire d’Arbovirus, Centres de Contrôle et de Prévention des Maladies

Analyse moléculaire

POWV ou DTV a été détecté par RT-PCR en temps réel dans l’échantillon CSF collecté en décembre mais pas dans l’échantillon CSF du seuil du cycle d’amplification du signal de janvier, indiquant que la charge virale en décembre était très faible Résultats des tests PCR en temps réel tous les autres virus étaient des tests de RT-PCR conventionnels négatifs pour la TVN, effectués sur l’échantillon de CSF de décembre, amplicons produits pour le séquençage, qui ont été édités et assemblés pour l’évaluation phylogénétique. L’analyse a montré que le virus était étroitement apparenté aux souches de TVN détecté dans les tiques I scapularis du Massachusetts dans et à partir d’un cas clinique antérieur de New York à la figure

Figure Vue largeTélécharger la diapositiveRévolution relationnelle des taxons déduite à l’aide de la méthode de jointure avec bootstrap réplique La relation était supportée par l’analyse avec la méthode de parcimonie maximale à partir d’un total de positions dans le jeu de données final. Les distances évolutives ont été calculées en utilisant la méthode spécifique aux données , et les unités représentent le nombre de substitutions de bases par site. Des analyses évolutives ont été effectuées en utilisant le logiciel MEGA R , DT-NY- et DTV -MN- non rapporté sont les seules souches connues de DTV issues de cas humains La souche nouvellement identifiée est en caractères gras et DTV soulignée, virus du tique du cerf; POWV, Powassan virusFigure View largeTélécharger la relationEvolutionnaire des taxons déduite à l’aide de la méthode neighbor-joining avec bootstrap réplique La relation était supportée par l’analyse avec la méthode de parcimonie maximale à partir d’un total de positions dans le jeu de données final. <% des réplicats bootstrap sont réduits Les distances évolutives ont été calculées en utilisant la méthode spécifique aux données , et les unités représentent le nombre de substitutions de bases par site Les analyses évolutives ont été effectuées en utilisant le logiciel MEGA R , DT-NY- et DTV-MN- non rapporté sont les seules souches connues de DTV provenant de cas humains. La souche nouvellement identifiée est en caractères gras et DTV soulignée, virus du tique du cerf; POWV, virus Powassan

DISCUSSION

Interféron, on ne sait pas si cette thérapie a joué un rôle bénéfique Un aspect notable de notre cas était la longue période d’incubation des jours de morsure de tiques connus avant l’apparition des symptômes. Les données des cas d’infection par POWV indiquent une période d’incubation allant de plusieurs jours. Basé sur le moment de l’année où la piqûre de tique a eu lieu en Octobre et la situation géographique du patient dans la Basse Hudson Valley de l’Etat de New York, cette tique était probablement un adulte I ScapularisDTV a été isolé pour la première fois. Angleterre Bien que le premier cas humain identifié d’encéphalite DTV ait également eu lieu dans , la preuve basée sur les données de séquence n’était pas disponible avant le séquençage complet du génome de la DTV. Les virus partagent une origine ancestrale commune en Amérique du Nord, d’où ils ont divergé en différentes lignées il y a des années et se sont adaptés pour différer t hôtes hôtes avec répartition géographique chevauchante au Canada et aux États-Unis Les deux virus sont considérés comme antigéniquement indiscernables malgré les titres PRNT nettement différents observés chez ce patient; par conséquent, une analyse génotypique est nécessaire pour un diagnostic définitif. Les tests sérologiques pour la TVN et le POWV peuvent également présenter une réaction croisée avec le VNO, le VLEV et d’autres flavivirus; Par conséquent, les dosages immunofluorescents doivent être confirmés soit avec des dosages d’anticorps neutralisants spécifiques, soit par PCR. POWV est trouvé chez Ixodes cookei, Ixodes marxi et Ixodes spinipalpus mais pas encore chez I scapularis DTV qui était à l’origine isolé des tiques Dermacentor andersoni. trouvé dans I scapularis Les principaux réservoirs hôtes du POWV sont la marmotte Marmota momax et la moufette rayée Mephitis mephitis , tandis que la TVN est maintenue dans un cycle enzootique distinct entre I scapularis et, vraisemblablement, la souris à pattes blanches Peromyscus leucopus [ Sur la base des données de PCR et du séquençage génomique, des taux d’infection à la TVN de l’ordre de% -% ont été observés chez des adultes I scapularis dans plusieurs zones géographiques, notamment dans l’île de Nantucket, Prudence Island, Bridgeport et le nord-ouest du Connecticut. , les villes de Spooner et Hayward dans le Wisconsin , comté de Suffolk à Long Island, New York, et le comté de Westchester, qui est dans le Bas-Hu dson Vallée de l’État de New York Entre% et% des souris de Spooner, Wisconsin et Nantucket Island présentaient des signes sérologiques d’exposition au POWV ou au DTV La transmission transstadiale de la TVN se produit à un taux de seulement% expérimentalement [ ] La transmission transovarienne du POWV chez les tiques I scapularis a été documentée à un taux de% A propos des cas humains d’encéphalite à virus Powassan ont été rapportés à partir de; La plupart des cas signalés depuis ont été diagnostiqués dans les États du Minnesota et du Wisconsin Il est important d’être conscient que la grande majorité des cas signalés comme POWV n’ont pas été diagnostiqués à l’aide du séquençage génétique et donc une fraction inconnue Les cas signalés dans l’État de New York entre et provenaient des comtés de Westchester et de Putnam, qui sont fortement endémiques pour la maladie de Lyme Bien que près de% des tiques Cookei aient été infectées par le virus POWV dans le sud du pays. Nouvelle-Angleterre , les humains sont beaucoup plus susceptibles d’être mordus par des tiques scapulaires que par des tiques ou cookei Il convient également de noter que la transmission de la TVD dans les systèmes de souris peut survenir est beaucoup plus rapide que pour les autres agents pathogènes reconnus transmissibles par cette espèce de tiques ; Ainsi, il semble plausible qu’il puisse y avoir beaucoup d’infections subcliniques avec DTV. L’infection par POWV / DTV est diagnostiquée par la présence de l’un des éléments suivants: détection d’ARN POWV / DTV dans des échantillons de liquide céphalo-rachidien; détection d’IgM spécifiques de POWV / DTV dans des échantillons de CSF; présence d’une augmentation d’un facteur ≥ d’anticorps neutralisants spécifiques au virus POWV / DTV dans des échantillons de sérum en série; ou la détection d’IgM spécifiques de POWV / DTV dans un échantillon de sérum et d’anticorps neutralisants spécifiques de POWV / DTV dans le même spécimen ou un spécimen ultérieur Les anticorps neutralisants sont considérés comme spécifiques de POWV / DTV si le titre POWV / DTV est supérieur ou égal au titre Les tests peuvent être obtenus dans certains laboratoires publics de santé publique ou au CDC DTV peut être différencié de POWV par séquençage génomique en utilisant des amorces de la région codante de l’enveloppe DTV prototype et la région codante NS En conclusion, l’encéphalite DTV est une cause rarement reconnue d’encéphalite dans les zones endémiques de la maladie de Lyme. Bien que les méthodes sérologiques soient plus communément utilisées pour le diagnostic de l’encéphalite POWV / DTV, le diagnostic initial et définitif a été fait par des tests moléculaires. relation phylogénétique entre cette souche de TVN et d’autres souches de POWV et de DTV rapportées dans la littérature et les bases de données publiques

Remarques

Remerciements Les auteurs remercient Valérie L Demarest pour l’assistance technique avec les tests sérologiques; Nicholas A. Smith pour l’assistance technique dans les essais moléculaires au Centre Wadsworth; Dr Andrea Habura pour des discussions et des conseils concernant l’analyse phylogénétique; et Jennifer L Hallisey, MPH, et Rachel Gressel, RN, MS, du Bureau of Communicable Disease Control, Département de santé de l’État de New York et du comté de Putnam, pour une assistance dans la collecte de données épidémiologiques. Soutien financier Ce travail a été soutenu en partie par Programme de bourse de recherche sur les maladies infectieuses émergentes, administré par l’Association des laboratoires de santé publique et financé par les conflits d’intérêts du CDCPotentiel Tous les auteurs: Aucun conflit signaléTous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels que les éditeurs jugent pertinents. le contenu du manuscrit a été divulgué